Microsatellite Markers

What Are They?

A genetic marker can be used to locate a specific segment of genetic material that has a known location on a chromosome. Microsatellite markers are one example of the many types of genetic markers available to measure genetic variation. Sometimes microsatellites are also called short tandem repeats (STRs) or simple sequence repeats (SSRs). They are simply segments of DNA where the nucleotide sequence repeats (i.e. the repeat of ATAG in the figure below). These repeating sequences (or microsatellites) are distributed throughout the genome.

image showing microsatellite marker

Why Are They Important in Conservation Genetics?

Microsatellite markers are inherited from both parents, making them useful for parentage analysis (think paternity testing) and population genetic studies. Microsatellite markers are useful for population genetic studies because many are considered highly polymorphic. If a microsatellite locus is polymorphic, it means that there is more than one potential allele at a single locus (a specific marker site). Polymorphic loci can have more than 10, even more than 20 potential alleles in that given population. If populations are truly separate from each other, then these alleles are likely to be present in different frequencies in each population. These different allele frequencies increase the potential to observe genetic differences between populations if they exist.

For example, let’s assume we have two populations that are reproductively isolated, but the microsatellite marker we are using only has one or two alleles present for that locus. In addition, the alleles occur at similar frequencies in both populations. The microsatellite data would suggest that these two populations are either one continuous population, or at least had high levels of gene flow between the populations. In this case, the lack of allelic diversity would limit our ability to detect reproductive isolation. Now, let’s assume we are using a microsatellite marker that has 20 possible alleles (highly polymorphic). This large number of alleles increases the odds that allele frequencies will differ between the populations if reproductive isolation is occurring, thus increasing the likelihood of properly identifying the two populations as separate (reproductively isolated from each other). In addition, if the data from the highly polymorphic locus still leads to the conclusion that the two populations are not reproductively isolated, then there would be stronger genetic support suggesting the two populations were either one population or had large amounts of gene flow. In reality, data from multiple microsatellite markers, not just one locus, are used to characterize populations.

Similarly, in parentage analysis, highly polymorphic loci increase our ability to identify individuals. In this case, the large number of alleles increases the likelihood that each individual will have a unique genotype (considering their genotype across multiple loci) relative to other individuals in the population. Similar to population studies, multiple loci are typically used in parentage analysis.

What can cause these differences in allele frequency between populations? Gene flow between populations can act to make allele frequencies more similar, even at low rates of exchange. Genetic drift, a random process, can cause allele frequencies to fluctuate within a population from one generation to the next. New alleles also can arise as a result of a mutation, resulting in the alteration in the number of repeating segments (increasing or decreasing the number of repeats). For example, the ATAGATAGATAGATAGATAGATAGATAGATAG in the figure above could be shortened to ATAGATAGATAG.

Who Cares?

Because microsatellites are generally considered to be selectively neutral (not influenced by natural selection), they are instead influenced by gene flow, genetic drift, and mutation, and are therefore useful for defining populations and estimating population differences.